bewellplus.gsu.edu
Heidi12
Heidi12 Heidi12
  • 13-10-2015
  • Mathematics
Answered

Quotient when 1,344 is divided by 7

Verified Answer :

Andrea0715 Andrea0715
  • 13-10-2015

the quotient would be 192

Answer Link
Anonymous Anonymous
  • 13-10-2015

Your answer to the problem would be:

192

Hope I Helped You!!! :-)

Have A Good Day!!!

Answer Link

Related Questions

Given the balanced equation representing a reaction 4Als 3O2ggt2Al2O3s Which type of chemical reaction is represented by this equation 1 double replacement 2 si
the area of the atlas mountains is in its rain shadow
Frank reads at least 24 pages but not more than 36 pages of a book He reads 12 pages per hour The number of hours Frank reads p pages is modeled by a function t
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG recall that DNA sequences are always written 5 to 3
The demonstrates the cell theory because it develops cells that fuse to form one giant cell making up the whole organism cork slime mold bacteria archaea
If it takes 4 people 60 minutes to paint 8 walls how long will it take 5 people to paint 4 walls
How do you convert 040 into a fraction
Soldiers were sent to the South to protect the rights of blacks as part of the governments attempt to give blacks the rights of full citizenship A True B False
what is a domain range and function
Can density be used to identify what a substance is made of