catcrazykay catcrazykay

21-03-2017
Mathematics

Answered

Which Is more 113.09 for $10 or 254.34 for $20

Verified Answer :

Zuigioverlord Zuigioverlord

21-03-2017

254.34 for 20$ is more.

254.34 for 20 $ = 127.17 for 10$

Answer Link

amelia18 amelia18

21-03-2017

The answer is 254.34 for $20.
Because the other one is 226.18 for $20.
254.34 for $20 is the best deal

Answer Link

Related Questions

The molecule is known as the universal energy source of the cell

The Commodities Futures Trade Commission is in charge of regulating the trade of commodities What are commodities a live animals and exotic wildlife b any stone

what was the first resulted in a change british

what is overlapping in digital arts

limit as n approaches infinity of 1n1n92n93n9nn9

What is the mRNA sequence to match the DNA sequence below TACGCTCCATATCGCTAATCGCCGGATCAGATT

A region that includes several interacting ecosystems is called

How did the Allies point of view affect Germany during the peace process after World War I

One example of a very complex land ecosystem full of thousands of kinds of living things

who knows how to crop an image on google slides

Web Analytics Made Easy - Statcounter