brandiriley0 brandiriley0

08-03-2017
Mathematics

Answered

Kylie bought a bunch of grapes that weigjed 2 pounds and 9 ounces.how much did the grapes weigh in ounces only?

Verified Answer :

wendy40 wendy40

08-03-2017

There are 16 ounces in a pound, so 2 pounds is 32 ounces, so 32 ounces plus 9 ounces is 41 ounces.

Answer Link

anahivargas anahivargas

08-03-2017

I got 41 if u know how to work it out

Answer Link

Related Questions

Most of the land masses in the world are in the Northern Hemisphere True False

Which of the following are credible information sources for a research paper blogs magazines academic journals research papers by experts college students peers

Which of the following does NOT describe the conversion of potential to kinetic energy The Sun emitting light A rocket leaving the Earths atmosphere Releasing a

the uterus gets ready to nurture a fertilized egg by

The sides of the cubes are numbered 1 through 6 If they are both tossed what is the probability that they will both be a 2 13 16 136

Which of the following would have an increased bmr tim who is recovering from surgery mary who is pregnant with twins sally who is 8 years old and is an avid sw

Katie borrowed 2500 at 10 interest for 5 years What was the total interest A 1250 B 12500 C 125000 D 1250000 PLEASE HELP QUICKLY

what is thermal pollution

In the gene TATTCATTGTTATGATTTATTCG CATTGTTA encodes for pepsin a digestive enzyme The rest of the sequence doesnt code for any protein Which sequence contains

Stan won 150 packs of gumin a contest His brother gave him 15 packs of gum How is the 1 in 150 different from the 1 in 15

Web Analytics Made Easy - Statcounter