deloresdeas deloresdeas

08-03-2017
Mathematics

Answered

what is the soluton to the system of equations graphed below? y=x+2 and y=3x-2

Verified Answer :

Anonymous Anonymous

08-03-2017

the second one i think

Answer Link

Millamarie Millamarie

08-03-2017

Yeah is the second one

Answer Link

Related Questions

Each person regardless of age or backgrounds have the right to krump How should the sentence above be rewritten to correct the subjectverb agreement error The s

George found that he blinked 85 times in 15 minutes At this rate how many seconds passed during 51 blinks

1 Yo profesor estoy soy 2 las diez Están Son 3 Los muchachos mexicanos están son 4 las nueve de la mañana Están Son 5 Ella de Bolivia está es 6 Hoy lunes está e

What was saltins major goal during world war 2

What is the mRNA sequence to match the DNA sequence below TACGCTCCATATCGCTAATCGCCGGATCAGATT

how do bones ligaments tendons and cartilage help each other in the body

The novel developed before drama

Compare between Thomas Hobbes John Locke and Rousseau in their democratic theory

A plane flew 2190 kilometers from Chicago to Flagstaff Another plane flew 2910 kilometers from Chicago to Oakland How much farther did the plane that flew to Oa

Joel earns 1700 per month If he spends 425 on rent each month what percent of his income does he spend on rent

Web Analytics Made Easy - Statcounter