Rocky716 Rocky716

01-03-2017
Mathematics

Answered

How to get the answer

How to get the answer class=

Verified Answer :

cupcakedogs cupcakedogs

05-03-2017

13x+5.5+13x+5.5+13x+5.5+13x+5.5=360
and then you just solve for x
hope this helps

Answer Link

Related Questions

A right triangle has three sides with the same length two sides that are parallel at least two congruent sides two sides that are perpendicular

Fill in the corresponding mRNA sequence of the DNA strand ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA

Find the product mnp3m 5n 7p

1 5 6 5 a 2 b 0 c 5 d 3

What is Science And why do Trees take in Carbon Dioxide

Which of the following is not a correct formula unit Select one a MgO b Ca2N3 c KCl d Li3N

which of the 13 states did not send men to participate in writing the constitution

Currently it is illegal to import prescription drugs into the United States despite the fact that US consumers could buy drugs from Canada at lower prices than

What is the process by which new rock is made from old rock

Which of the following people is not correctly matched to the industry or business he is historically associated with A John D Rockefelleroil B John P Morganinv

Web Analytics Made Easy - Statcounter