miapackard miapackard

20-12-2016
Biology

Answered

In terms of energy, what is the difference between glucose and ATP

Verified Answer :

dooleyr dooleyr

20-12-2016

ATP contains phosphorus and nitrogen

glucose is broken down into water and carbon dioxide

Answer Link

Related Questions

Which country lawyer from Ashtabula Ohio argued that criminals are not born but are made by the unjust condition of human life

The study of body structure is called

for cutting dress fabric its recommended that you use

In about 75 words identify whether the four italicized words in this passage from Oedipus the King are nominative or objective pronouns and explain why that is

The owner of a bike shop sells unicycles and bicycles and keeps inventory by counting seats and wheels One day she counts 21 seats and 30 wheels The equation re

Camilla is 14 years old She is onethird of her teachers age How old is her teacher

I knew a woman lovely in her bones When small birds sighed she would sigh back at them Ah when she moved she moved more ways than one The shapes a bright contai

You live in an area that the Assyrian army is attempting to conquer Write a speech that you might give to your neighbors to persuade them either to defend thems

how to find the depth of a rectangular prism I already have the length width ad the volume But Im confused on how to find the height

In the gene TATTCATTGTTATGATTTATTCG CATTGTTA encodes for pepsin a digestive enzyme The rest of the sequence doesnt code for any protein Which sequence contains

Web Analytics Made Easy - Statcounter