ashamcgraw ashamcgraw

19-12-2016
Physics

Answered

How many atoms make up this molecule: C6H14

A1
B6
C14
D20

Verified Answer :

mmmcguire mmmcguire

19-12-2016

D carbon has 6 and hydrogen has 14

Answer Link

Related Questions

Here are parts of the DNA base sequences for 7 organisms Organism 1 GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2 GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3 GCTAAGCA

What is the unit rate of 50 meters over 408 seconds

800 hm cm please help me i relay cant find out the answer

How many chromosome would be found in dog gametes how many chromosomes would be found in deer mouse brain cells how many chromosomes would be found in deer mous

Patel received an allowance of 15 per week How many week will it take him to purchase the kit

Michael exchanged 1000 US dollars for the Croatian currency witch is called Kuna the exchange rate was 581 Kuna to 1 How many Crotion did Michael get Explain ho

Hair can be used to measure humidity a True b False

Checkin officially logs you in at the incident the checkin process and information help to ensure personnel accountability track resources prepare personnel for

For Questions 13 choose the word or phrase that best matches the word in italics 1 The gall he displayed during his exchange with the police officer made us all

Use Newtons method to approximate a root of the equation cosx2 3 x3 as follows Let x1 1 be the initial approximation The second approximation x2 is

Web Analytics Made Easy - Statcounter