msholoqueen msholoqueen

18-12-2016
Social Studies

Answered

use Columbian exchange in a sentence

Verified Answer :

AHLOVERGIRL AHLOVERGIRL

18-12-2016

The Colombian exchange refers to a period in time where cultural and biological exchanges between the New and Old worlds.
Good luck! Have a nice day!

Answer Link

Related Questions

Select the true statement A RNA is mostly singlestranded DNA is always doublestranded B RNA and DNA usually have identical nitrogenous bases C Several types of

Geometry help please

Explain how you can find 4x754 different two way

Given the DNA template AATAGTACGCGAGTCGTGATGAAATTCT A DNA replication Write the sequence of complementary bases produced if the above undergoes replication B Tr

Georges highest target heart rate is 170 Yesterday on the stair stepper machine his heart rate went to 172 What should he do the next time he uses this machine

What is the largest remainder you can make by dividing 25

GCF of 40 48 56 98 121

009 is 10 times as much as

Which graph represents the function y 2x2 5 Can someone explain how to get the answer

Imagine your family is hosting a foreign exchange student from China named YiMen YiMen is enjoying learning about American culture and asks you to tell her how

Web Analytics Made Easy - Statcounter