cdizzle02 cdizzle02

09-12-2016
Mathematics

Answered

1.5x-2<10 how do you solve this

Verified Answer :

baabaagreysheep baabaagreysheep

09-12-2016

5x - 2 < 10
+ 2
5x < 12
÷ 5
x < 2.4
Hope this helped!

Answer Link

Related Questions

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene 3TAAACTGTACAGGGCCATAACT5

According to classification if two organisms are in the same class then they must be in the same kingdom and

Terrell has a BMI of 30 Which statement is true about what this BMI indicates about Terrell ahe has a slight risk of weight related disease bhe has a high risk

Hurrryyyy True or false In a process called plucking the rocks dragged by glaciers produce grooves and scratches on bedrock

A gamma ray has a very high frequency of about 1019 s1 what is the wavelength of the gamma ray

University libraries are to the public A hostile B closed C inaccessible D open

In which order were these documents written and adopted 1 US Constitution 2 Bill of Rights 3 Declaration of Independence 4 Articles of Confederation A 1243 B 24

Write an entry for your blog which describes a place that you have visited which has affected you or stayed in your memory and explain why this is so 16 marks P

Hemingway is preoccupied with

How did the pax Romana influence people living in the Roman Empire

Web Analytics Made Easy - Statcounter