D4ardrese8mmaka D4ardrese8mmaka

17-11-2016
History

Answered

The Byzantine Empire fell in:

1453

1543

337

1100

Verified Answer :

totally totally

17-11-2016

may 29, 1453 is when the empire fell

Answer Link

Related Questions

I need help with a name for my novel it involves two cops that one of them is a crooked cop and the other one falls in love with him but I need a name for the s

What is the slope of the line through 1 9 and 3 16

Write a phrase for each algebraic expression 8p

what is 022 as a decimal

What is the total number of electrons found in an atom of sulfur 1 6 2 8 3 16 4 32

The school cafeteria offered a choice of pizza or nachos to sixthgrade students Seventyseven students chose pizzaThis represented 35 of the sixthgrade class How

10 POINTS The United Arab Emirates was controlled by Great Britain until 1971 Great Britain divided the region into seven territories emirates They hoped to cre

1 What are Internet cookies What are they used for What information can forensic scientists gain from them

Which answer provides the best explanation of the phrase international interdependence The ability of multiple countries to profit from a single crop The unity

Here are parts of the DNA base sequences for 7 organisms Organism 1 GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2 GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3 GCTAAGCA

Web Analytics Made Easy - Statcounter