loverangel121 loverangel121

15-11-2016
History

Answered

where did germany begin its war offensive, and what happend there

Verified Answer :

15-11-2016

It invaded Belgium and ended up creating a refugee crisis.

Answer Link

thisguy18 thisguy18

15-11-2016

what war exactly? in WW2 Germany first attacked and occupied Poland and conquered it. In WW1 Germany first occupied Belgium

Answer Link

Related Questions

A continental shelf is characterized by all of the following EXCEPT a Abundant life c High amounts of sunlight b Shallow water d High sediment buildup

It took a farmer 7 12 hours to plant 18 acre with plants What is the unit rate in acres per hour

Which pair is a base and corresponding height for the triangle A b 16 units and h 96 units B b 20 units and h 16 units C b 20 units and h 96 units D b 20 units

the questions are attached

What is 9 59 6 56

Hey guys I would be thankful if anyone could help me answer this question A can manufacturing company needs to purchase labels for the cans they produce They ar

Part 1 CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks 3

Can anyone explain to me me how long division works briefly or in detail For 20pts

how many fifths are in 18

Is mice like cheese a fragment or a sentence

Web Analytics Made Easy - Statcounter