bewellplus.gsu.edu
Anonymous Anonymous
  • 10-11-2016
  • History
Answered

The Boston Massacre occurred when __________.


A.

British soldiers fired on a crowd of troublemakers


B.

colonists attacked and killed British soldiers


C.

Native Americans were attacked by land-seeking colonists


D.

colonists threw barrels of tea into Boston Harbor

Verified Answer :

agentblack agentblack
  • 10-11-2016
ABritish soldiers fired on a crowd of trouble makers
Answer Link
vquin
vquin vquin
  • 10-11-2016

The answer would be A

Answer Link

Related Questions

What are equivalent expressions for 64x80
543q show work and step by step
what were the first 5 species of humans on earth in order
Fill in the corresponding mRNA sequence of the DNA strand ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA
who else is homeschool and has trouble
Read the excerpt from Act V scene i of Romeo and Juliet Romeo Is it even so then I defy you stars Thou knowst my lodging get me ink and paper And hire posthorse
6 Which one of the following phrases contains vivid words that create imagery A Sang a solo B Twenty soldiers C Cottonlike clouds D Traveled far
The disputed election of 1824 caused a split in the democraticrepublican party that resulted in the creation of which two new political parties a the progressiv
The subject of rockwells works were
do you think the compromise of 1877 was a good idea and why