rebeccajones33 rebeccajones33

06-11-2016
Chemistry

Answered

A student measures the length of a 1.00 m standard bar. He obtains measurements of 0.99 m, 1.01 m, and 1.00 m. Which describes his measurements?

Aprecise but not accurate

Baccurate but not precise

Cneither precise nor accurate

Dboth precise and accurate

Verified Answer :

Ligalas99 Ligalas99

06-11-2016

The correct answer is (D. both precise and accurate.

Answer Link

abell2002 abell2002

06-11-2016

I think D both precise and accurate

Answer Link

Related Questions

Which artistic tradition developed as a reaction against the industrial revolution

The sum of two numbers is 48 If one third of one number is 5 greater than one sixth of another number which of the following is the smaller number 6 22 26 42 pl

what are nonexamples of independence

Analysis Ouestions Use the back of this sheet if you need more room for your answers 1 Explain the inheritance pattern of the ear lobe attachment trait Explain

What number can be subtracted from both the numerator and the denominator of this fraction to produce the fraction on the right 3453 12

Fill in the corresponding mRNA sequence of the DNA strand ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA

use the trapezoid to solve the problem

Which lines in this excerpt from act II of William Shakespeares Romeo and Juliet best convey Friar Laurences ideas about the coexistence of good and evil FRIAR

Alicia has 32 stickers this is four times as many stickers as Bonita has how many stickers does Bonita have

how many monarchs did purcell experience in his lifetime

Web Analytics Made Easy - Statcounter