janetbrown247 janetbrown247

03-11-2016
World Languages

Answered

Pronoun indicates a person place thing and what else

Verified Answer :

Anjiebby Anjiebby

04-11-2016

It also indicates idea.

Answer Link

Related Questions

Can you guys help please with 7811and 12can you show me the work as wellWill mark brainliest answer

I need help with this plz 10 questions for 30 pts Question 1 What was an effect of the Iconoclastic Controversy Council decisions ultimately brought the East an

Which sentence uses the word set correctly The ushers asked the audience to set through the entire show We need to set boxes of bottled water on shelves close t

Choose the paragraph heading most likely to be found in a long essay about various activities to do at the beach Parasailing Hanggliding Snorkeling and More Wha

Have you ever read the book Ben and Me Because here is a question about the book when the two country yokels find Bens clothes what do they think Why Why do you

a recipe for icecream includes 34 cup of milk 13 cup cream and 18 cup sugar which shows the amounts from least to greatest

A bike rider travels 58 miles 5 hours a What is the unit rate that describes the bike rides speed in miles per hour

1 Write about the nicest trip you have ever been on 1214 lines

which country was the titanic closet to when it sank

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG recall that DNA sequences are always written 5 to 3

Web Analytics Made Easy - Statcounter