how do errors in grammer, spelling and punctuation effect the a story to a reader

Question

15-10-2016
English

Answered

how do errors in grammer, spelling and punctuation effect the a story to a reader

Verified Answer :

Related Questions

In the gene TATTCATTGTTATGATTTATTCG CATTGTTA encodes for pepsin a digestive enzyme The rest of the sequence doesnt code for any protein Which sequence contains

75x3 hurrryyyyyyyyyyyyyyyyyyyy

An is a wet fertile area in a desert where a natural spring or well provides water A oasis B silt C canal D delta

Kahulugan ng komentaryong pangradyo

A truck with 48indiameter wheels is traveling at 45 mih a Find the angular speed of the wheels in radmin radmin b How many revolutions per minute do the wheels

which was not a reason for the king of Spain to be cautious

Where did most of the nations manufacturing take place during the first decade of the 1800s A in homes B in schools C in churches D in factories

Kurt drew a rectangular maze with a length of 34 foot and an width of 512 foot What is the are in square feet on f kurts maze

How do you write 7720 in a decimal

shelbyy612 shelbyy612 · Answer 1 · 2016-10-15T14:05:59-04:00

shelbyy612 shelbyy612

15-10-2016

Because you could be seeing a picture of a story and you end up studding on a error or mistake of the writer do the reader will have to fix it themselves of the reading in the passage

Answer Link

Allison112200 Allison112200 · Answer 2 · 2016-10-15T14:12:53-04:00

Allison112200 Allison112200

15-10-2016

it can confuse the reader along the way when they read it. and make them realize the author who wrote it is not very good

Answer Link