Danielagj Danielagj

27-09-2016
Mathematics

Answered

Logan ate1.438 pounds of grapes his brother Ralph are 1.44 pounds of grapes which brother are more grapes

Verified Answer :

Jamiesen Jamiesen

27-09-2016

Ralph ate more grapes

Answer Link

SweetSavie SweetSavie

27-09-2016

Ralph would have eaten more grapes. The way that you compare decimals is you make sure that they all go out to the same place value. So what we would do is: 1.438 (stays the same)
1.440 (you add a zero to the end) so,

1.440
- 1.438
========
0.2

Answer Link

Related Questions

Please help with all three questions show work if can help ASAP

702 Seasons Writing Assignment Write a composition or a letter in Spanish to a friend where you include the following items Use the following tips to help you w

Which of the following sentences is correctly punctuated Get over the fact that you didnt make it on the cheerleading team she said and just try to get on anoth

Given the DNA template AATAGTACGCGAGTCGTGATGAAATTCT A DNA replication Write the sequence of complementary bases produced if the above undergoes replication B Tr

The change in status for women as they assisted the war effort at home was to play a role in helping them to be able to do what later on

Which president would not run for re election in 1968 carter reagan ford johnson

What transformation has changed the parent function fx log4 x to its new appearance shown in the graph below fx 5 4 fx 5 4 fx 5 5 fx 5 5

Simplify 14y1122134y12

0100kilogram apple falls from a height of 150 meters to 100 meters Ignoring frictional effects what is the kinetic energy of the apple at this height 000 J 049

A politician who is fiscally liberal would MOST LIKELY support

Web Analytics Made Easy - Statcounter