16-06-2016
Mathematics

Answered

(-6)(-2)(-1) quick What's the answer

Verified Answer :

KSIxShadowFlame KSIxShadowFlame

16-06-2016

-6 multiplied by -2 would be +12
+12 multiplied by -1 would be -12
so your answer is -12 :)

Answer Link

michaelaalexis2 michaelaalexis2

16-06-2016

the answer is -12...

Answer Link

Related Questions

how many gram of nitrogen are needed to produce 325 gram of ammonia n2g 3h2g 2nh3g

Name a a law that you must follow every day What does this law do How does it affect you What does this law do Why or why not

Which statement about kushs history is true Kush was conquered by Greece Kush was unsuccessfully invaded by Rome Kush controlled all of Egypt at one point Kush

A substance that is known to cause cancer is called a a mutagen b carcinogen c terotagen d garbage

Which environmental changes occur faster Avolcanic eruption Bregrowth of forest after volcanic eruption

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene 3TAAACTGTACAGGGCCATAACT5

which element must an effective wartime speech have

What is your opinion on Mormon Churches making it illegal to have samesex parents and get baptized

The vertices of a quadrilateral are 0 2 4 2 3 0 and 4 0 what type of quadrilateral is it A parallelogram B rectangle C trapezoid D rhombus

President Carter assumed the role of peacemaker to negotiate which of the following between Israel and Egypt a Geneva Accords b Peace of Paris c Camp David Acco