07-06-2016
History

Answered

What was the goal of the Boston Port Bill of the 1770s?

Verified Answer :

metchelle metchelle

13-06-2016

The Boston Port Act of 1774 was designed as a way for Great
Britain to show its colonies that it would not take protests lightly. The act
was a response to the Boston Tea Party incident where an entire shipment of tea
was destroyed by protesters.

Answer Link

cosmicdaisychain cosmicdaisychain

20-01-2021

Answer:

To punish Massachusetts by closing Boston Harbor

Explanation:

Answer Link

Related Questions

Explain how one small act can have large and farreaching effects

Sugar also travels in the blood stream to all parts of the body Does sugar travel into the body cells in the same way Why or why not Explain your answer

Which of the following is true of chronic stress in human beings A It is temporary B It may lead to persistent autonomic nervous system arousal C It involves ex

Here are parts of the DNA base sequences for 7 organisms Organism 1 GCCTAGGCATTACGCTACGTCGCATTATAC Organism 2 GCTAAGGCACTACGCTACGTCGCTTAATAG Organism 3 GCTAAGCA

How can I use whisker rose in a comparing sentence with more or most

What is the solution of the system Use substitution 4x y 5 3x 7 2 A 3 7 B 7 7 C 3 7 D 34 25

In what setting do all frequencies of electromagnetic waves travel at the same speed

Why math is important and why you like math In your own opinion Please give me answer

What do decomposers do with the nutrients that they break down

In this excerpt from Michael Wigglesworths Day of Doom choose the correct meaning for each underlined word They rush from beds with giddy heads and to their win

Web Analytics Made Easy - Statcounter