j9a3zmeblixHmagloves j9a3zmeblixHmagloves

16-05-2016
Mathematics

Answered

Clara drove 248 miles in 4 hours. what was her average rate of speed

Verified Answer :

BossLife123 BossLife123

16-05-2016

Hi there, to solve this problem we divide 248 miles by 4 hours. Let's begin, 248 miles ÷ 4 hours = 62. Therefore, Clara's average rate of speed was 62.

Answer Link

Related Questions

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene 3TAAACTGTACAGGGCCATAACT5

What caused the french and indian war

Find the height of a baseball with a mass of 015 kg that has a GPE of 735 J Help please

Which describes the underlined word in the sentence The boys were playing a game of chess 0000000 Adirect object Bindirect object Cpredicate adjective Dpredicat

The supreme executive power shall be vested in a governor who shall be commanderinchief of all military forces of the state not in active service of the United

Whales have what seem like remnants of a pelvis and femur as shown here What are these structures an example of

An effective claim for an argumentative essay is

40 cm 4 m A gt B lt C

A school custodian waxed the gymnasium floor that measured 20 feet by 20 feet How many square feet did she have to wax

How do you put KansasNebraska Act in a sentence